Last Activity: 05-08-2013 06:47 PM
About Me
- About rufsketch1
- Biography
- Generic 22 year old.
- Gender
- Male
- Location
- In his own twisted abstraction of an incomprehensible reality.
- Interests
- Art, Programming, Math, Physics, Poetry, Philosophy, Your Mother, Psychology.
- Personality
- MBTI Type
- INTP
- Global 5/SLOAN
- RCUeI
- Personal DNA
- GTTCGACGGTCCGATTGCTT
- Brain Dominance
- Balanced
Friends
Showing Friends 1 to 18 of 18
-
9 Guillotines is offline
-
AliTree is offline
-
Amphorian is offline
-
Apophenia is offline
-
Dasein is offline
-
enfpchick is offline
-
EtaProduct is offline
-
H264 is offline
-
JulietCapulet is offline
-
lifesight is offline
-
Marcus Septim is offline
-
Monte314 is offline
-
ntwady is offline
-
Reon is offline
-
SelfMadeBum is online
-
Syntax is offline
-
UrWrongImRit is offline
-
wolfhunter is offline





