Visitor Messages

Showing Visitor Messages 1 to 20 of 25
  1. Straylight
    12-24-2012 11:29 AM
    Straylight
    Thought I'd just say merry Christmas to everyone on my friends list.

    So happy Christmas Kookoonuts

    You haven't been around for ages, hope lifes treating you good.
  2. Monte314
    08-05-2012 11:38 AM
    Monte314
    I was acting like a jerk... it was well-deserved.
  3. Nonsuch
    08-03-2012 09:37 AM
    Nonsuch
    Hey I like the way you think !
  4. Psychotropic
    Yeah, you definitely have to look through the tests that your Doctor is ordering.
  5. Straylight
    07-21-2012 04:54 PM
    Straylight
    I'm 36. phew. do the sexy English accent again. lol
  6. Straylight
    07-21-2012 04:40 PM
    Straylight
    lol. It is so important to be able to addresss one's father in the correct manner.
    how old are you anyway?
  7. Straylight
    07-21-2012 04:30 PM
    Straylight
    Look if I want to do some stalking I want to do it in the most efficient way possible. I'm just practical that way.
  8. Straylight
    07-21-2012 03:39 PM
    Straylight
    Yeah when I used to live in London and come back to Bournemouth to visit family I could smell a change in the air about half way.
    I've decided I need more than 1 friend and you are the ideal person.
  9. Straylight
    07-21-2012 01:27 PM
    Straylight
    I feel my picture may have mislead you a little, for 48 weeks of the year it actually looks more like this.

    And 3 of the remaining 4 are like this.
    http://img3.photographersdirect.com/img/15588/wm/pd2339464.jpg

    But for that 1 week it's very nice, the tricky bit is getting it to coincide with your holiday
  10. Straylight
    07-21-2012 12:12 PM
    Straylight
    I've lived all over the place like you. Not abroad though, except for a short period in NY. I've always been around the south coast of england and spent about 7-8 years in London. Now I'm in a town called Bournemouth which is the area I grew up in. Bournemouth is weird mix of the very young and the very old. The young people come from all the language schools, university and colleges and the old people like to retire here. There are things I miss about London but there are much worse places to live.
  11. 24601
    07-20-2012 07:52 PM
    24601
    LMAO! Well, fortunately or unfortunately, no Val Jeanian crisis here, at least.

    Not yet.
  12. Straylight
    07-20-2012 05:37 PM
    Straylight
    Albion is England's romantic half forgotten memory. Much like. Winning is the England football team's romantic half forgotten memory.
    I see you're from Seattle, which if I remember rightly has a very famous oddly shaped building. You like it there?
  13. Straylight
    07-20-2012 10:53 AM
    Straylight
    I just can't understand abandoning your kids to the world whether you originally wanted them or not. Seems cut and dry to me, and I don't have kids.
    When you find your drawings you should attach n' post em' - it's always interesting to see another persons creativity at work.
  14. Storm
    07-19-2012 07:39 PM
    Storm
    That is the position the law takes, and it made perfect sense to me.
  15. Monte314
    07-19-2012 07:06 PM
    Monte314
    N-Dimensionally spatial? Spatial frequency spatial?
  16. Storm
    07-19-2012 06:12 PM
    Storm
    I know. I find it bizarre.
  17. Straylight
    07-19-2012 05:39 PM
    Straylight
    lol, the stuff of men's nightmares
  18. Pipedown
    07-19-2012 01:57 PM
    Pipedown
    Try one of the airline size bottles of Belvedere then. Its got a kick to it with a slight vanilla hint that is super tasty. Get it in the freezer and all syrupy before you try though.
  19. Pipedown
    07-19-2012 01:39 PM
    Pipedown
    Its really good. Almost drinkable plain. You should try it
  20. Nostalgia

About Me

  • About kookoonuts
    Biography
    I have nowhere to go but sane.
    Gender
    Female
    Location
    Seattle Area
    Interests
    pianos, puzzles, corsets, candles, socks, boxes, roadtrips, pistols, sashimi, laughter, growth
    Occupation
    Aerospace Monkey
  • Personality
    MBTI Type
    INTJ
    Personal DNA
    GTCAAATAACCCGGACCCTATATAT
    Brain Dominance
    Balanced

Statistics

Total Posts
Visitor Messages
General Information
  • Last Activity: 01-20-2013 03:50 AM
  • Join Date: 07-15-2012
  • Referrals: 0

Friends

Showing Friends 1 to 3 of 3

Contact Info

Instant Messaging
Send an Instant Message to kookoonuts Using...
This Page
http://intjforum.com/member.php?u=24781

All times are GMT -7. The time now is 06:18 PM.


Powered by vBulletin®
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Myers-Briggs Type Indicator, Myers-Briggs, and MBTI are trademarks or registered trademarks of the
Myers-Briggs Type Indicator Trust in the United States and other countries.